Eriosoma lanigerum (Hausmann, 1802)

Primary tabs

EOL Text

Associations:

Foodplant / gall
Eriosoma lanigerum causes gall of white woolly-covered branch of Malus
Remarks: season: 3-

Foodplant / gall
Eriosoma lanigerum causes gall of white woolly-covered branch of Malus domestica
Remarks: season: 3-

Foodplant / gall
Eriosoma lanigerum causes gall of white woolly-covered branch of Cotoneaster
Remarks: season: 3-

Foodplant / gall
Eriosoma lanigerum causes gall of white woolly-covered branch of Pyracantha
Remarks: season: 3-

Animal / predator
larva of Heringia is predator of Eriosoma lanigerum

Animal / predator
larva of Neocnemodon vitripennis is predator of Eriosoma lanigerum

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorBioImages, BioImages - the Virtual Fieldguide (UK)
Sourcehttp://www.bioimages.org.uk/html/Eriosoma_lanigerum.htm

Barcode data: Eriosoma lanigerum:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTTTATTCGGAATATGATCAGGAATAATTGGTTCATCTTTAAGAATCTTAATTCGATTAGAATTAAGACAAATTAATTCTATTATTAACAATAATCAATTATATAATGTAATCGTTACAATTCATGCTTTTATTATAATTTTTTTTATAACAATACCAATTGTAATTGGAGGTTTTGGAAACTGATTAATTCCTATAATAATAGGATCTACTGATATATCTTTTCCACGATTAAATAATATTAGTTTTTGATTATTACCCCCTTCTTTAATAATAATAATTTGTAGATTTATTATTAATAATGGAACAGGAACAGGATGAACAATTTATCCACCATTATCAAATAATATTGCTCATAATAATATTTCAGTTGATTTAACAATTTTTTCTCTTCATTTAGCAGGAATTTCATCTATTTTAGGTGCAATTAATTTTATTTGCACTATTATAAATATAATACCAAATAATATAAAACTAAATCAAATTCCCTTATTCCCATGATCAATTTTAATTACAGCAATTTTGTTAATTCTATCTTTACCTGTATTAGCAGGTGCAATTACTATACTTTTAACTGATCGAAATCTAAATACCTCATTTTTTGATCCATCAGGAGGAGGAGACCCAATTTTATATCAACATTTATTN
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=22428

Statistics of barcoding coverage: Eriosoma lanigerum:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 15
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=22428

Eriosoma lanigerum:

The Woolly Apple Aphid, (Eriosoma lanigerum), is an aphid in the superfamily Aphidoidea in the order Hemiptera. It is a true bug and sucks sap from plants.

Host plants[edit]

References[edit]

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorWikipedia
Sourcehttp://en.wikipedia.org/w/index.php?title=Eriosoma_lanigerum&oldid=649567066
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith