Dendroctonus micans (Kugelann, 1794)

Primary tabs

EOL Text

Barcode data: Dendroctonus micans:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCTCTGTAGATTGCGCGATTTTTAGTCTTCATATGGCAGGCATCTCCTCCATTCTTGGAGCTATTAACTTTATTTCTACAATTATAAATATAAATCCCTCAGGAATAAAACTAGATCGGCTAACTTTATTCACCTGATCAGTAAAAATTACAGCTATTTTACTATTATTATCGTTACCAGTACTGGCCGGAGCTATTACTATATTATTGACAGATCGAAATATTAATACTACTTTCTTCGATCCTTCTGGGGGTGGAGATCCTATTTTATACCAACATCTATTCTGATTCTTTGGACACCCAGAAGTTTACATTTTAATTTTACCAGGATTCGGTATAATCTCACATATTATCAGACAAGAAAGAGGGAAAAAAGAAGCTTTTGGATTACTAGGAATAATTTATGCTATAATAGCAATTGGATTACTAGGATTTGTAGTATGAGCCCACCATATATTCACAGTAGGCATAGATGTAGATACCCGAG
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=32006

Statistics of barcoding coverage: Dendroctonus micans:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=32006
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith