Eulachnus rileyi (Williams)

Primary tabs

EOL Text

Syntype for Lachnus rileyi Williams, 1911
Catalog Number: USNM 399894.001
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Male;;; Adult; Wings Alate
Preparation: Slide section
Collector(s): T. Williams
Year Collected: 1888
Locality: University of Nebraska - Lincoln City Campus, Lancaster, Nebraska, United States

  • Syntype: Williams, T. A. 1911. The Aphididae of Nebraska. University Studies of the University of Nebraska. 10: 85-175.
Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorThis image was obtained from the Smithsonian Institution. Unless otherwise noted, this image or its contents may be protected by international copyright laws.
Sourcehttp://collections.mnh.si.edu/search/ento/?irn=9324455

Syntype for Lachnus rileyi Williams, 1911
Catalog Number: USNM 399893.001
Collection: Smithsonian Institution, National Museum of Natural History, Department of Entomology
Sex/Stage: Female;;; Adult; Wings Apterous
Preparation: Slide section
Collector(s): T. Williams
Year Collected: 1888
Locality: University of Nebraska - Lincoln City Campus, Lancaster, Nebraska, United States

  • Syntype: Williams, T. A. 1911. The Aphididae of Nebraska. University Studies of the University of Nebraska. 10: 85-175.
Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorThis image was obtained from the Smithsonian Institution. Unless otherwise noted, this image or its contents may be protected by international copyright laws.
Sourcehttp://collections.mnh.si.edu/search/ento/?irn=9324453

Barcode data: Eulachnus rileyi:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATAGGATCTTCATTAAGAATTTTAATTCGTTTAGAATTAAGTCAAATTAATTCAATTATTAATAATAATCAATTATATAATGTAATTGTTACAATTCACGCTTTTATTATAATTTTTTTTATAACAATACCAATTGTTATTGGAGGATTTGGAAATTGATTAATCCCTTTAATAATAGGATCTCCTGATATAGCTTTCCCACGACTTAATAATATTAGATTTTGACTTTTGCCTCCCTCATTAATACTAATAATTTGTAGATTTATAATTAATAACGGAACAGGAACCGGATGAACTATTTATCCACCTTTATCTAATAATATCGCACATAACAATATATCAGTTGATATAACTATTTTTTCACTTCATTTAGCAGGTATTTCATCAATTATAGGTGCAATTAATTTTATTTGCACTATTTTAAATATAATACCTAATAATTTAAAAATCAATCAAATTCCTCTATTCCCATGATCAATTTTAATTACAGCTATTCTTTTAATTTTATCATTACCTGTATTAGCAGGTGCAATTACTATACTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCATCTGGAGGAGGTGATCCTATTCTATATCAACATCTATTN
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=22453

Statistics of barcoding coverage: Eulachnus rileyi:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 14
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=22453
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith