Gymnocephalus cernuus (Linnaeus, 1758)

Primary tabs

EOL Text

Dorsal spines (total): 11 - 19; Dorsal soft rays (total): 11 - 16; Analspines: 2; Analsoft rays: 5 - 6; Vertebrae: 35 - 36

Licensehttp://creativecommons.org/licenses/by-nc/3.0/
Rights holder/AuthorPascualita Sa-a, FishBase
Sourcehttp://www.fishbase.org/summary/SpeciesSummary.php?id=4474

Spawns in spring and early summer. High reproductive capacity. In Europe, mature in 2-3 years; may mature in one year in warmer waters. May live up to 7 years (males) or 11 years (females).

Licensehttp://creativecommons.org/licenses/by-nc/3.0/
Rights holder/AuthorHammerson, G., NatureServe
Sourcehttp://explorer.natureserve.org/servlet/NatureServe?searchName=Gymnocephalus+cernuus

Inhabits lakes, quiet pools and margins of streams. Prefers deep water with deposits of sand and gravel (Ref. 9696). The membranous external walls of the head canals of this species provide high directional sensitivity; can feed at night in the dark using the lateral line system; feeds on zooplankton, chironomids, oligochaetes and amphipods (Ref. 10999).

Licensehttp://creativecommons.org/licenses/by-nc/3.0/
Rights holder/AuthorPascualita Sa-a, FishBase
SourceNo source database.

Length: 25 cm

Licensehttp://creativecommons.org/licenses/by-nc/3.0/
Rights holder/AuthorHammerson, G., NatureServe
Sourcehttp://explorer.natureserve.org/servlet/NatureServe?searchName=Gymnocephalus+cernuus

Barcode data: Gymnocephalus cernua:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACTTCCCTAAGTCTGCTCATTCGGGCAGAACTAAGCCAGCCCGGCGCCCTCCTTGGGGACGACCAAATTTATAACGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGGGGCTTTGGGAACTGGCTTATTCCACTTATGATCGGCGCCCCCGACATGGCATTTCCTCGAATAAATAACATAAGCTTCTGGCTCCTACCACCTTCGTTTCTGCTCCTCCTTGCTTCCTCAGGAGTAGAAGCAGGAGCTGGCACTGGATGAACCGTCTACCCTCCCCTATCAGGAAACTTAGCACATGCCGGCGCATCTGTTGACCTAACCATCTTTTCCCTTCATTTGGCAGGGATCTCCTCAATCTTGGGCGCAATTAATTTTATTACAACCATTATTAACATAAAACCTCCTGCTATTTCCCAGTACCAAACCCCACTATTTGTGTGAGCCGTCCTGATCACAGCCGTCCTACTCCTCCTTTCCCTTCCTGTGCTCGCCGCTGGCATTACAATGCTTCTCACAGATCGAAACTTAAACACCACCTTCTTTGACCCTGCGGGAGGGGGCGATCCCATCCTCTACCAACATTTA
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=398376

Maximum size: 250 mm TL

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorFishWise Professional, FishWise Professional
Sourcehttp://www.fishwisepro.com/Species/details.aspx?Zoom=True&SId=13904

Statistics of barcoding coverage: Gymnocephalus cernua:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 18
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=398376

Max. size:

25.0 cm TL (male/unsexed; (Ref. 556)); max. published weight: 400 g (Ref. 556); max. reported age: 10 years (Ref. 59043)

Licensehttp://creativecommons.org/licenses/by-nc/3.0/
Rights holder/AuthorCrispina B. Binohlan, FishBase
Sourcehttp://www.fishbase.org/summary/SpeciesSummary.php?id=4474

Barcode data: Gymnocephalus cernuus:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACTGCCCTAAGTCTGCTCATTCGGGCAGAACTAAGCCAGCCCGGCGCCCTCCTTGGGGACGACCAAATTTATAACGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGGGGCTTTGGGAACTGGCTTATTCCACTTATGATCGGCGCCCCCGACATGGCATTTCCTCGAATAAATAACATAAGCTTCTGGCTCCTACCACCTTCGTTTCTGCTCCTCCTTGCTTCCTCAGGAGTAGAAGCAGGAGCTGGCACTGGATGAACCGTCTACCCTCCCCTATCAGGAAACTTAGCACATGCCGGCGCATCTGTTGACCTAACCATCTTTTCCCTTCATTTGGCAGGGATCTCCTCAATCTTGGGCGCAATTAATTTTATTACAACCATTATTAACATAAAACCTCCTGCTATTTCCCAGTACCAAACCCCACTATTTGTGTGAGCCGTCCTGATCACAGCCGTCCTACTCCTCCTTTCCCTTCCTGTGCTCGCCGCTGGCATTACAATGCTTCTCACAGATCGAAACTTAAACACCACCTTCTTTGACCCTGCGGGAGGGGGCGATCCCATCCTCTACCAACATTTA
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=71248

Distinguished uniquely from its congeners by its body depth 24-27% SL. Differs further from other members of the genus by the combination of having a flank yellowish with numerous, small, irregular, dark blotches and having 11-16 dorsal spines (Ref. 59043). Caudal fin with 16 to 17 rays (Ref. 40476). Dorsal fins are fused. Color brownish with dark spots (Ref. 35388).

Licensehttp://creativecommons.org/licenses/by-nc/3.0/
Rights holder/AuthorPascualita Sa-a, FishBase
Sourcehttp://www.fishbase.org/summary/SpeciesSummary.php?id=4474
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith